Stem-loop sequence cel-mir-1830

AccessionMI0008200 (change log)
DescriptionCaenorhabditis elegans miR-1830 stem-loop
Literature search

2 open access papers mention cel-mir-1830
(2 sentences)

Stem-loop
   --    g    a               --  -c  a 
5'   cgag uuuc cguuuucuaggccac  gc  gc a
     |||| |||| |||||||||||||||  ||  || a
3'   gcuc aaag guaaaggauccggug  cg  cg u
   cg    a    a               uu  ac  a 
Get sequence
Deep sequencing
4419 reads, 5.88 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 4371838-4371907 [-]
sense
B0286.3 ; B0286.3; intron 1
Database links

Mature sequence cel-miR-1830-5p

Accession MIMAT0006772
Previous IDscel-miR-1830
Sequence

1 - 

cgagguuucacguuuucuaggcc

 - 23

Get sequence
Deep sequencing129 reads, 9 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence cel-miR-1830-3p

Accession MIMAT0020778
Sequence

48 - 

ccuaggaaaugagaaaacucggc

 - 70

Get sequence
Deep sequencing4283 reads, 17 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3