Stem-loop sequence cel-mir-1829c

AccessionMI0008199 (change log)
DescriptionCaenorhabditis elegans miR-1829c stem-loop
Gene family MIPF0000460; mir-1829
Literature search

2 open access papers mention cel-mir-1829c
(2 sentences)

Stem-loop
   ----a  c       a  a        aa  a 
5'      ag gaaauuc ag ugguugua  ac u
        || ||||||| || ||||||||  || c
3'      uc cuuuaag uc accaacau  ug g
   cguua  u       g  -        ca  a 
Get sequence
Deep sequencing
17946 reads, 106 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 15236362-15236423 [-]
sense
F39B1.1 ; F39B1.1; intron 20
Clustered miRNAs
< 10kb from cel-mir-1829c
cel-mir-4812chrX: 15242774-15242849 [-]
cel-mir-1829cchrX: 15236362-15236423 [-]
Database links

Mature sequence cel-miR-1829c-5p

Accession MIMAT0006771
Previous IDscel-miR-1829c
Sequence

1 - 

aagcgaaauucaagaugguugua

 - 23

Get sequence
Deep sequencing17201 reads, 17 experiments
Evidence experimental; 454 [1], Illumina [2], CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-1829c-3p

Accession MIMAT0032038
Sequence

39 - 

caaccacuggaauuucucuauu

 - 60

Get sequence
Deep sequencing745 reads, 17 experiments
Evidence not experimental
Database links

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).