Stem-loop sequence cel-mir-1829b

AccessionMI0008198 (change log)
DescriptionCaenorhabditis elegans miR-1829b stem-loop
Gene family MIPF0000460; mir-1829
Literature search

1 open access papers mention cel-mir-1829b
(1 sentences)

Stem-loop
   --a  c  uc      a         a  a 
5'    ag ga  uucuag ugguuguaa ac u
      || ||  |||||| ||||||||| || c
3'    uc cu  aagguc accaacauu ug g
   uua  u  uu      -         a  a 
Get sequence
Deep sequencing
54527 reads, 388 reads per million, 17 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 14977119-14977178 [+]
sense
F20D1.3 ; F20D1.3; intron 2
Database links

Mature sequence cel-miR-1829b-5p

Accession MIMAT0006770
Previous IDscel-miR-1829b
Sequence

1 - 

aagcgaucuucuagaugguugua

 - 23

Get sequence
Deep sequencing53785 reads, 17 experiments
Evidence experimental; 454 [1], Illumina [2], CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-1829b-3p

Accession MIMAT0032037
Sequence

39 - 

caaccacuggaauuucucuauu

 - 60

Get sequence
Deep sequencing740 reads, 17 experiments
Evidence not experimental
Database links

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).