Stem-loop sequence cel-mir-1828

AccessionMI0008196 (change log)
DescriptionCaenorhabditis elegans miR-1828 stem-loop
Stem-loop
   --g       uu  c g         cu  gc 
5'    aucacuu  au g uuccggucc  cu  a
      |||||||  || | |||||||||  ||  a
3'    uagugaa  ua c aaggucagg  ga  a
   uga       uu  - g         -u  aa 
Get sequence
Deep sequencing
27 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 10600463-10600525 [+]
sense
T22A3.5a ; T22A3.5a; intron 6
Database links

Mature sequence cel-miR-1828

Accession MIMAT0006768
Sequence

41 - 

acuggaagcauuuaagugauagu

 - 63

Get sequence
Deep sequencing21 reads, 5 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).