Stem-loop sequence hsa-mir-320c-2

AccessionMI0008191 (change log)
Symbol HGNC:MIR320C2
DescriptionHomo sapiens miR-320c-2 stem-loop
Gene family MIPF0000163; mir-320
Literature search

145 open access papers mention hsa-mir-320c-2
(591 sentences)

Stem-loop
   --gcaugacag        uu       c     ag 
5'            gccuucuc  uccaguu uuccc  a
              ||||||||  ||||||| |||||   
3'            ugggagag  gggucga aaggg  a
   aaagaaaagaa        uu       a     uu 
Get sequence
Deep sequencing
1469695 reads, 4.29e+03 reads per million, 161 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 24321675-24321746 [+]
sense
OTTHUMT00000447043 ; CHST9-AS1-004; intron 1
OTTHUMT00000446547 ; CHST9-AS1-002; intron 3
ENST00000579964 ; AQP4-AS1-004; intron 1
ENST00000582605 ; AQP4-AS1-002; intron 3
Database links

Mature sequence hsa-miR-320c

Accession MIMAT0005793
Sequence

42 - 

aaaagcuggguugagagggu

 - 61

Get sequence
Deep sequencing2828473 reads, 159 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).