Stem-loop sequence cfa-mir-92a-2

AccessionMI0008175 (change log)
DescriptionCanis familiaris miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --    g     uu   g  u     -      
5'   gggu gggau  gug ca uacuu guguu 
     |||| |||||  ||| || ||||| |||| c
3'   uccg cccug  cac gu augaa uauac 
   ug    g     uu   -  u     a      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 104895826-104895886 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-92a-2
cfa-mir-106achrX: 104896518-104896574 [-]
cfa-mir-18bchrX: 104896339-104896415 [-]
cfa-mir-20bchrX: 104896091-104896158 [-]
cfa-mir-19b-2chrX: 104895962-104896025 [-]
cfa-mir-92a-2chrX: 104895826-104895886 [-]
cfa-mir-363chrX: 104895657-104895723 [-]
Database links

Mature sequence cfa-miR-92a

Accession MIMAT0006653
Sequence

40 - 

uauugcacuugucccggccugu

 - 61

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).