Stem-loop sequence cfa-mir-19b-2

AccessionMI0008174 (change log)
DescriptionCanis familiaris miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   --        -  -      uuu    gua     g 
5'   guuuugca gg uuugca   cagc   cuugu c
     |||||||| || ||||||   ||||   |||||  
3'   caaaacgu cc aaacgu   gucg   ggaua a
   gu        a  u      ---    ---     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 104895962-104896025 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-19b-2
cfa-mir-106achrX: 104896518-104896574 [-]
cfa-mir-18bchrX: 104896339-104896415 [-]
cfa-mir-20bchrX: 104896091-104896158 [-]
cfa-mir-19b-2chrX: 104895962-104896025 [-]
cfa-mir-92a-2chrX: 104895826-104895886 [-]
cfa-mir-363chrX: 104895657-104895723 [-]
Database links

Mature sequence cfa-miR-19b

Accession MIMAT0006652
Sequence

43 - 

ugugcaaauccaugcaaaacug

 - 64

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).