Stem-loop sequence cfa-mir-106a

AccessionMI0008173 (change log)
DescriptionCanis familiaris miR-106a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ---a        a  g     ---gua  a 
5'     aagugcuu ca ugcag      gc u
       |||||||| || |||||      || u
3'     uucacgaa gu acguc      cg c
   auuc        c  a     aucuag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 104896518-104896574 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-106a
cfa-mir-106achrX: 104896518-104896574 [-]
cfa-mir-18bchrX: 104896339-104896415 [-]
cfa-mir-20bchrX: 104896091-104896158 [-]
cfa-mir-19b-2chrX: 104895962-104896025 [-]
cfa-mir-92a-2chrX: 104895826-104895886 [-]
cfa-mir-363chrX: 104895657-104895723 [-]
Database links

Mature sequence cfa-miR-106a

Accession MIMAT0006749
Sequence

1 - 

aaagugcuuacagugcagguag

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).