Stem-loop sequence cfa-mir-503

AccessionMI0008170 (change log)
DescriptionCanis familiaris miR-503 stem-loop
Gene family MIPF0000183; mir-503
Stem-loop
   --ua                 g   u g  a 
5'     gcagcgggaacaguacu cag g gc a
       ||||||||||||||||| ||| | || u
3'     cgucgucuuuguuauga guc u ug c
   ggcc                 g   u g  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 105183139-105183201 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-503
cfa-mir-424chrX: 105183437-105183493 [-]
cfa-mir-503chrX: 105183139-105183201 [-]
cfa-mir-542chrX: 105178359-105178417 [-]
cfa-mir-450achrX: 105177439-105177529 [-]
cfa-mir-450bchrX: 105177287-105177344 [-]
Database links

Mature sequence cfa-miR-503

Accession MIMAT0006746
Sequence

1 - 

uagcagcgggaacaguacug

 - 20

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).