Stem-loop sequence cfa-mir-424

AccessionMI0008169 (change log)
DescriptionCanis familiaris miR-424 stem-loop
Gene family MIPF0000164; mir-322
Stem-loop
   --      aa            agu   uu 
5'   agcagc  uucauguuuuga   gcu  a
     ||||||  ||||||||||||   |||   
3'   ucgucg  gagugcaaaacu   ugg  a
   ua      cg            ---   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 105183437-105183493 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-424
cfa-mir-424chrX: 105183437-105183493 [-]
cfa-mir-503chrX: 105183139-105183201 [-]
cfa-mir-542chrX: 105178359-105178417 [-]
cfa-mir-450achrX: 105177439-105177529 [-]
cfa-mir-450bchrX: 105177287-105177344 [-]
Database links

Mature sequence cfa-miR-424

Accession MIMAT0006745
Sequence

37 - 

caaaacgugaggcgcugcuau

 - 57

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).