Stem-loop sequence cfa-mir-224

AccessionMI0008168 (change log)
DescriptionCanis familiaris miR-224 stem-loop
Gene family MIPF0000088; mir-224
Stem-loop
   --ca         u   u      a u   ug  u 
5'     agucacuag ggu ccguuu g aga  au a
       ||||||||| ||| |||||| | |||  || u
3'     ucagugauc ccg gguaaa c uuu  ua g
   aacg         -   u      a -   gu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chrX: 119925345-119925413 [-]
sense
ENSCAFT00000030414 ; GABRE-201; intron 6
Clustered miRNAs
< 10kb from cfa-mir-224
cfa-mir-452chrX: 119926379-119926463 [-]
cfa-mir-224chrX: 119925345-119925413 [-]
Database links

Mature sequence cfa-miR-224

Accession MIMAT0006744
Sequence

1 - 

caagucacuagugguuccguuu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).