Stem-loop sequence cfa-mir-144

AccessionMI0008158 (change log)
DescriptionCanis familiaris miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   -a  -        a         a  uug g 
5'   gg auaucauc uauacugua gu   c a
     || |||||||| ||||||||| ||   | c
3'   uc uguaguag auaugacau ca   g a
   ga  a        -         -  -ua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 43031035-43031094 [-]
sense
ENSCAFT00000043143 ; TLCD1-201; intron 1
antisense
ENSCAFT00000029869 ; cfa-mir-451-201; exon 10
Clustered miRNAs
< 10kb from cfa-mir-144
cfa-mir-144chr9: 43031035-43031094 [-]
cfa-mir-451chr9: 43030863-43030931 [-]
Database links

Mature sequence cfa-miR-144

Accession MIMAT0006734
Sequence

39 - 

uacaguauagaugauguacuag

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).