Stem-loop sequence cfa-mir-22

AccessionMI0008157 (change log)
DescriptionCanis familiaris miR-22 stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
   --          -     a      u  ccu 
5'   aguucuucag uggca gcuuua gu   g
     |||||||||| ||||| |||||| ||   a
3'   ucaagaaguu accgu cgaaau cg   c
   ug          g     -      -  acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 45852534-45852593 [-]
sense
ENSCAFT00000032633 ; cfa-mir-22-201; exon 1
Database links

Mature sequence cfa-miR-22

Accession MIMAT0006733
Sequence

39 - 

aagcugccaguugaagaacugu

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).