Stem-loop sequence cfa-mir-181a-2

AccessionMI0008152 (change log)
DescriptionCanis familiaris miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --a   u      cu       a    ggga 
5'    aca ucaacg  gucggug guuu    u
      ||| ||||||  ||||||| ||||    u
3'    ugu aguugc  cagccac caaa    u
   cca   c      --       -    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 58302547-58302606 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-181a-2
cfa-mir-181a-2chr9: 58302547-58302606 [-]
cfa-mir-181b-2chr9: 58301314-58301373 [-]
Database links

Mature sequence cfa-miR-181a

Accession MIMAT0006707
Sequence

1 - 

aacauucaacgcugucggugag

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).