Stem-loop sequence cfa-mir-199-3

AccessionMI0008151 (change log)
DescriptionCanis familiaris miR-199-3 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   --       u       u    u  ----  a 
5'   ccagugu uagacua cugu ca    gg c
     ||||||| ||||||| |||| ||    ||  
3'   gguuaca gucugau gaca gu    cc u
   uu       c       -    u  uaaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr9: 55262354-55262412 [+]
sense
ENSCAFT00000032720 ; cfa-mir-199-3-201; exon 1
antisense
ENSCAFT00000045981 ; DNM1-201; intron 10
ENSCAFT00000031957 ; DNM1-202; intron 16
Database links

Mature sequence cfa-miR-199

Accession MIMAT0006642
Sequence

39 - 

acaguagucugcacauugguu

 - 59

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).