Stem-loop sequence cfa-mir-127

AccessionMI0008132 (change log)
DescriptionCanis familiaris miR-127 stem-loop
Gene family MIPF0000080; mir-127
Stem-loop
   ccu   g         g  c      --  a 
5'    gcu aagcucaga gg ucugau  uc g
      ||| ||||||||| || ||||||  || a
3'    cgg uucgagucu cc aggcua  ag a
   --u   -         g  u      cu  a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69104938-69104997 [+]
sense
ENSCAFT00000032725 ; cfa-mir-127-201; exon 1
antisense
ENSCAFT00000028454 ; cfa-mir-432-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-127
cfa-mir-665chr8: 69097904-69097971 [+]
cfa-mir-433chr8: 69103838-69103911 [+]
cfa-mir-127chr8: 69104938-69104997 [+]
cfa-mir-432chr8: 69106415-69106501 [+]
cfa-mir-136chr8: 69106615-69106670 [+]
Database links

Mature sequence cfa-miR-127

Accession MIMAT0006713
Sequence

39 - 

ucggauccgucugagcuuggcu

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).