Stem-loop sequence cfa-mir-9-1

AccessionMI0008125 (change log)
DescriptionCanis familiaris miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc               g      u  ug 
5'     uuugguuaucuagcu uaugag gg  u
       ||||||||||||||| |||||| ||  g
3'     aagccaauagaucga auacuu cu  g
   auga               a      -  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr7: 41509404-41509465 [+]
antisense
ENSCAFT00000032656 ; cfa-mir-9-1-201; exon 1
Database links

Mature sequence cfa-miR-9

Accession MIMAT0006674
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).