Stem-loop sequence cfa-mir-199-2

AccessionMI0008124 (change log)
DescriptionCanis familiaris miR-199-2 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   --       u        c   --uca  ac 
5'   ccagugu cagacuac ugu     gg  a
     ||||||| |||||||| |||     ||   
3'   gguuaca gucugaug aca     cc  a
   uu       c        -   uguug  gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr7: 26812766-26812824 [+]
sense
ENSCAFT00000032702 ; cfa-mir-199-2-201; exon 1
antisense
ENSCAFT00000023557 ; DNM3-201; intron 13
ENSCAFT00000023561 ; DNM3-202; intron 14
Clustered miRNAs
< 10kb from cfa-mir-199-2
cfa-mir-199-2chr7: 26812766-26812824 [+]
cfa-mir-214chr7: 26818559-26818668 [+]
Database links

Mature sequence cfa-miR-199

Accession MIMAT0006642
Sequence

39 - 

acaguagucugcacauugguu

 - 59

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).