Stem-loop sequence cfa-mir-29b-2

AccessionMI0008121 (change log)
DescriptionCanis familiaris miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   --a          c      g  u    uuuucc 
5'    gcugguuuca auggug cu agau      a
      |||||||||| |||||| || ||||       
3'    ugacuaaagu uaccac ga ucua      u
   uug          u      -  -    uguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr7: 6651878-6651943 [-]
sense
ENSCAFT00000032737 ; cfa-mir-29b-2-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-29b-2
cfa-mir-29b-2chr7: 6651878-6651943 [-]
cfa-mir-29c-2chr7: 6651339-6651396 [-]
Database links

Mature sequence cfa-miR-29b

Accession MIMAT0006625
Sequence

44 - 

uagcaccauuugaaaucaguguu

 - 66

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).