Stem-loop sequence cfa-mir-93

AccessionMI0008110 (change log)
DescriptionCanis familiaris miR-93 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --ca       -     u    g   u  g u 
5'     aagugcu guucg gcag uag gu a u
       ||||||| ||||| |||| ||| || | a
3'     uucacga cgagu cguc auc ca u c
   gccc       u     -    -   -  g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr6: 9498780-9498840 [+]
sense
ENSCAFT00000023450 ; MCM7-201; intron 13
Clustered miRNAs
< 10kb from cfa-mir-93
cfa-mir-106bchr6: 9498558-9498616 [+]
cfa-mir-93chr6: 9498780-9498840 [+]
cfa-mir-25chr6: 9498993-9499051 [+]
Database links

Mature sequence cfa-miR-93

Accession MIMAT0006696
Sequence

1 - 

caaagugcuguucgugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).