Stem-loop sequence cfa-mir-34c

AccessionMI0008106 (change log)
DescriptionCanis familiaris miR-34c stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --a   a    a     c      c  a 
5'    ggc gugu guuag ugauug ua u
      ||| |||| ||||| |||||| ||  
3'    ccg caca caauc acuaac au a
   gga   g    c     -      c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr5: 21558106-21558160 [-]
sense
ENSCAFT00000022554 ; C11orf88-201; intron 1
ENSCAFT00000032743 ; cfa-mir-34c-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-34c
cfa-mir-34bchr5: 21558685-21558768 [-]
cfa-mir-34cchr5: 21558106-21558160 [-]
Database links

Mature sequence cfa-miR-34c

Accession MIMAT0006693
Sequence

1 - 

aggcaguguaguuagcugauugc

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).