Stem-loop sequence cfa-mir-34a

AccessionMI0008101 (change log)
DescriptionCanis familiaris miR-34a stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --u        -   a          gugaguaa 
5'    ggcagugu cuu gcugguuguu        u
      |||||||| ||| ||||||||||         
3'    ccgucaua gaa cgacuaacga        a
   auc        u   -          aggaagug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr5: 62485832-62485897 [-]
intergenic
Database links

Mature sequence cfa-miR-34a

Accession MIMAT0006690
Sequence

1 - 

uggcagugucuuagcugguugu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).