Stem-loop sequence cfa-mir-146a

AccessionMI0008094 (change log)
DescriptionCanis familiaris miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   --u            c        g  uc 
5'    gagaacugaauu cauggguu ug  a
      |||||||||||| |||||||| ||  g
3'    uucuugacuuga guguccag ac  u
   gac            a        -  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr4: 50248597-50248654 [-]
intergenic
Database links

Mature sequence cfa-miR-146a

Accession MIMAT0006684
Sequence

1 - 

ugagaacugaauuccauggguu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).