Stem-loop sequence cfa-mir-7-2

AccessionMI0008085 (change log)
DescriptionCanis familiaris miR-7-2 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   --   a     a u     u       ucuca 
5'   ugg agacu g gauuu guuguug     c
     ||| ||||| | ||||| |||||||      
3'   acc ucuga c cugaa caacaac     u
   ac   g     c -     -       cuacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr3: 51802454-51802515 [+]
intergenic
Database links

Mature sequence cfa-miR-7

Accession MIMAT0006634
Sequence

1 - 

uggaagacuagugauuuuguugu

 - 23

Get sequence
Evidence by similarity; MI0000265
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).