Stem-loop sequence cfa-mir-16-2

AccessionMI0008084 (change log)
DescriptionCanis familiaris miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --u         ua        c  ag   aau 
5'    agcagcacg  aauauugg gu  uga   a
      |||||||||  |||||||| ||  |||    
3'    ucgucgugu  uuauaacc ca  auu   a
   auu         ua        a  -a   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr34: 26460807-26460871 [+]
sense
ENSCAFT00000022729 ; SMC4-201; intron 4
Clustered miRNAs
< 10kb from cfa-mir-16-2
cfa-mir-15bchr34: 26460663-26460722 [+]
cfa-mir-16-2chr34: 26460807-26460871 [+]
Database links

Mature sequence cfa-miR-16

Accession MIMAT0006648
Sequence

1 - 

uagcagcacguaaauauuggcg

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).