Stem-loop sequence cfa-mir-15b

AccessionMI0008083 (change log)
DescriptionCanis familiaris miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --u       c  c      ua   a  ac 
5'    agcagca au augguu  cau cu  a
      ||||||| || ||||||  ||| ||  g
3'    ucgucgu ua uacuaa  gua ga  u
   auc       u  u      gc   -  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr34: 26460663-26460722 [+]
sense
ENSCAFT00000032748 ; cfa-mir-15b-201; exon 1
ENSCAFT00000022729 ; SMC4-201; intron 4
Clustered miRNAs
< 10kb from cfa-mir-15b
cfa-mir-15bchr34: 26460663-26460722 [+]
cfa-mir-16-2chr34: 26460807-26460871 [+]
Database links

Mature sequence cfa-miR-15b

Accession MIMAT0006676
Sequence

1 - 

uagcagcacaucaugguuua

 - 20

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).