Stem-loop sequence cfa-mir-9-2

AccessionMI0008081 (change log)
DescriptionCanis familiaris miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   --uc               g      ug a 
5'     uuugguuaucuagcu uaugag  u u
       ||||||||||||||| ||||||  |  
3'     aagccaauagaucga auacuu  g u
   auga               a      cu g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr3: 19997697-19997756 [+]
sense
ENSCAFT00000032729 ; cfa-mir-9-2-201; exon 1
Database links

Mature sequence cfa-miR-9

Accession MIMAT0006674
Sequence

1 - 

ucuuugguuaucuagcuguauga

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).