Stem-loop sequence cfa-mir-146b

AccessionMI0008073 (change log)
DescriptionCanis familiaris miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   --ug        a    a        ga  u 
5'     agaacuga uucc uaggcugu  gc u
       |||||||| |||| ||||||||  ||  
3'     ucuugacu aggg auccgaca  cg g
   gugg        c    -        aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr28: 14940550-14940610 [+]
intergenic
Database links

Mature sequence cfa-miR-146b

Accession MIMAT0006667
Sequence

1 - 

ugagaacugaauuccauaggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).