Stem-loop sequence cfa-mir-107

AccessionMI0008072 (change log)
DescriptionCanis familiaris miR-107 stem-loop
Gene family MIPF0000024; mir-103
Stem-loop
   --    u  u           c   u   a 
5'   agcu cu uacaguguugc uug ggc u
     |||| || ||||||||||| ||| ||| g
3'   ucgg ga auguuacgacg aac uug g
   ua    -  c           -   -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr28: 4484653-4484710 [-]
sense
ENSCAFT00000032573 ; cfa-mir-107-201; exon 1
Database links

Mature sequence cfa-miR-107

Accession MIMAT0006666
Sequence

38 - 

agcagcauuguacagggcuau

 - 58

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).