Stem-loop sequence cfa-mir-130b

Accession MI0008064
Description Canis familiaris miR-130b stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
--a       cc         a  guggg  g 
   cucuuuc  uguugcacu cu     cc c
   |||||||  ||||||||| ||     ||  
   gggaaag  guaacguga ga     gg u
uac       ua         c  ----a  g 
Get sequence
Genome context
Coordinates (CanFam2) Overlapping transcripts
chr26: 33988966-33989025 [+]
sense
Clustered miRNAs
< 10kb from cfa-mir-130b
cfa-mir-301b chr26: 33988637-33988712 [+]
cfa-mir-130b chr26: 33988966-33989025 [+]

Mature sequence cfa-miR-130b

Accession MIMAT0006659
Sequence

39 - 

cagugcaaugaugaaagggcau

 - 60

Get sequence
Evidence experimental; Solexa [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).