Stem-loop sequence cfa-mir-1-1

AccessionMI0008060 (change log)
DescriptionCanis familiaris miR-1-1 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   --               gc     ---   a 
5'   cauacuucuuuauau  ccaua   ugg c
     |||||||||||||||  |||||   ||| c
3'   guaugaagaaaugua  gguau   auc u
   au               -a     cga   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr24: 46481078-46481136 [+]
antisense
Clustered miRNAs
< 10kb from cfa-mir-1-1
cfa-mir-1-1chr24: 46481078-46481136 [+]
cfa-mir-133cchr24: 46490501-46490586 [+]
Database links

Mature sequence cfa-miR-1

Accession MIMAT0006656
Sequence

39 - 

uggaauguaaagaaguaugua

 - 59

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).