Stem-loop sequence cfa-mir-20a

AccessionMI0008052 (change log)
Previous IDscfa-mir-20
DescriptionCanis familiaris miR-20a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ---ua                 g   -  uu 
5'      aagugcuuauagugcag uag ug  u
        ||||||||||||||||| ||| ||   
3'      uucacgaguauuacguc auc au  c
   ugaaa                 -   u  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr22: 42478462-42478520 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-20a
cfa-mir-17chr22: 42478013-42478071 [+]
cfa-mir-18achr22: 42478138-42478229 [+]
cfa-mir-19achr22: 42478298-42478355 [+]
cfa-mir-20achr22: 42478462-42478520 [+]
cfa-mir-19b-1chr22: 42478598-42478656 [+]
cfa-mir-92a-1chr22: 42478714-42478772 [+]
Database links

Mature sequence cfa-miR-20a

Accession MIMAT0006651
Previous IDscfa-miR-20
Sequence

1 - 

uaaagugcuuauagugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).