Stem-loop sequence cfa-mir-15a

AccessionMI0008048 (change log)
DescriptionCanis familiaris miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --ua        ua          ga  u 
5'     gcagcaca  augguuugug  uu u
       ||||||||  ||||||||||  || g
3'     cgucgugu  uaccggacgu  aa a
   acuc        ua          gg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr22: 1846880-1846938 [+]
sense
ENSCAFT00000032594 ; cfa-mir-15a-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-15a
cfa-mir-15achr22: 1846880-1846938 [+]
cfa-mir-16-1chr22: 1847020-1847084 [+]
Database links

Mature sequence cfa-miR-15a

Accession MIMAT0006647
Sequence

1 - 

uagcagcacauaaugguuugu

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).