Stem-loop sequence cfa-mir-24-2

AccessionMI0008041 (change log)
DescriptionCanis familiaris miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
   --c  g   a         aaca     gauu 
5'    gu ccu cugagcuga    caguu    u
      || ||| |||||||||    |||||     
3'    ca gga gacuugacu    gucag    g
   gga  a   c         --cg     acgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr20: 48620684-48620745 [+]
sense
ENSCAFT00000034996 ; cfa-mir-24-2-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-24-2
cfa-mir-23achr20: 48620335-48620386 [+]
cfa-mir-27achr20: 48620556-48620615 [+]
cfa-mir-24-2chr20: 48620684-48620745 [+]
Database links

Mature sequence cfa-miR-24

Accession MIMAT0006614
Sequence

40 - 

uggcucaguucagcaggaacagg

 - 62

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).