Stem-loop sequence cfa-mir-27a

AccessionMI0008040 (change log)
DescriptionCanis familiaris miR-27a stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   --         ug  u       -  g cca 
5'   gggcuuagc  cu gugagca ga u   c
     |||||||||  || ||||||| || |    
3'   cuugaaucg  ga cacuugu cu a   a
   gc         gu  -       g  g acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr20: 48620556-48620615 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-27a
cfa-mir-23achr20: 48620335-48620386 [+]
cfa-mir-27achr20: 48620556-48620615 [+]
cfa-mir-24-2chr20: 48620684-48620745 [+]
Database links

Mature sequence cfa-miR-27a

Accession MIMAT0006641
Sequence

41 - 

uucacaguggcuaaguuccg

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).