Stem-loop sequence cfa-mir-181c

AccessionMI0008034 (change log)
DescriptionCanis familiaris miR-181c stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --aa        cu       a     ggca 
5'     cauucaac  gucggug guuug    g
       ||||||||  ||||||| |||||    c
3'     gugaguug  cagcuac caaac    u
   ccag        -c       -     ggac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr20: 48593343-48593403 [-]
sense
ENSCAFT00000032687 ; cfa-mir-181c-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-181c
cfa-mir-181cchr20: 48593343-48593403 [-]
cfa-mir-181dchr20: 48593158-48593221 [-]
Database links

Mature sequence cfa-miR-181c

Accession MIMAT0006635
Sequence

1 - 

aacauucaaccugucggugaguu

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).