Stem-loop sequence cfa-mir-7-1

AccessionMI0008033 (change log)
DescriptionCanis familiaris miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Stem-loop
   --   a     a       u      --     a 
5'   ugg agacu gugauuu guuguu  uuuag u
     ||| ||||| ||||||| ||||||  |||||  
3'   acc ucuga cacuaaa caacag  aaauc a
   au   g     -       -      cu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 75509765-75509828 [+]
sense
ENSCAFT00000032698 ; cfa-mir-7-1-201; exon 1
Database links

Mature sequence cfa-miR-7

Accession MIMAT0006634
Sequence

1 - 

uggaagacuagugauuuuguugu

 - 23

Get sequence
Evidence by similarity; MI0000265
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).