Stem-loop sequence cfa-mir-383

AccessionMI0008026 (change log)
DescriptionCanis familiaris miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   --a      aa    a        uug   gga 
5'    gaucag  ggug uuguggcu   ggu   u
      ||||||  |||| ||||||||   |||    
3'    cugguc  ucac gacaccga   cua   a
   aga      cg    -        ---   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr16: 38173722-38173783 [-]
sense
ENSCAFT00000032697 ; cfa-mir-383-201; exon 1
Database links

Mature sequence cfa-miR-383

Accession MIMAT0006629
Sequence

1 - 

agaucagaaggugauuguggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).