Stem-loop sequence cfa-mir-135a-2

AccessionMI0008025 (change log)
Previous IDscfa-mir-135
DescriptionCanis familiaris miR-135a-2 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   --           u            u g a 
5'   uuauggcuuuu auuccuauguga a u a
     ||||||||||| |||||||||||| | | u
3'   aguaccgaagg uagggauguacu u a a
   aa           -            c g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr15: 37181419-37181480 [+]
sense
ENSCAFT00000032712 ; cfa-mir-135a-2-201; exon 1
Database links

Mature sequence cfa-miR-135a-5p

Accession MIMAT0010196
Sequence

2 - 

uauggcuuuuuauuccuauguga

 - 24

Get sequence
Evidence by similarity; MI0000452
Predicted targets

Mature sequence cfa-miR-135a-3p

Accession MIMAT0006628
Previous IDscfa-miR-135
Sequence

41 - 

uguagggauggaagccaugaaa

 - 62

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).