Stem-loop sequence cfa-mir-219-1

AccessionMI0008007 (change log)
DescriptionCanis familiaris miR-219-1 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   --u   u     a  g         a   ucu 
5'    gau gucca ac caauucucg guc   g
      ||| ||||| || ||||||||| |||   g
3'    cug caggu ug guugagagc cgg   c
   gcc   -     c  a         -   ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr12: 2670928-2670990 [+]
intergenic
Database links

Mature sequence cfa-miR-219-5p

Accession MIMAT0006611
Previous IDscfa-miR-219
Sequence

1 - 

ugauuguccaaacgcaauucu

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).