Stem-loop sequence cfa-mir-206

AccessionMI0008002 (change log)
DescriptionCanis familiaris miR-206 stem-loop
Gene family MIPF0000038; mir-1
Stem-loop
   --                cc    ----   g 
5'   acaugcuucuuuauau  ccau    acg a
     ||||||||||||||||  ||||    ||| u
3'   ugugugaaggaaugua  ggua    ugc u
   gg                -a    ucgu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr12: 19805523-19805582 [+]
intergenic
Database links

Mature sequence cfa-miR-206

Accession MIMAT0006606
Sequence

39 - 

uggaauguaaggaagugugugg

 - 60

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).