Stem-loop sequence cfa-mir-101-2

AccessionMI0007995 (change log)
DescriptionCanis familiaris miR-101-2 stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   --              c a    guaua 
5'   gguuaucaugguac g ugcu     u
     |||||||||||||| | ||||      
3'   ucaauagugucaug c augg     c
   ag              a -    aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 93194328-93194382 [+]
sense
ENSCAFT00000032637 ; cfa-mir-101-2-201; exon 1
ENSCAFT00000003309 ; RCL1-201; intron 8
Database links

Mature sequence cfa-miR-101

Accession MIMAT0006600
Sequence

36 - 

uacaguacugugauaacuga

 - 55

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).