Stem-loop sequence cfa-mir-31

AccessionMI0007994 (change log)
DescriptionCanis familiaris miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   --a     g   c         -u   gaa 
5'    ggcaa aug uggcauagc  guu   c
      ||||| ||| |||||||||  |||    
3'    ccguu uac accguaucg  caa   u
   cua     a   a         uc   gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr11: 40904438-40904496 [-]
sense
ENSCAFT00000040001 ; cfa-mir-31-201; exon 1
Database links

Mature sequence cfa-miR-31

Accession MIMAT0006599
Sequence

1 - 

aggcaagaugcuggcauagcugu

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).