Stem-loop sequence cfa-mir-26a-2

AccessionMI0007990 (change log)
DescriptionCanis familiaris miR-26a-2 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   --uu         c          guuucc 
5'     caaguaauc aggauaggcu      g
       ||||||||| ||||||||||       
3'     guucauuag ucuuauccgg      u
   cuuu         u          aguguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr10: 1880513-1880572 [-]
sense
ENSCAFT00000000434 ; AGAP2-201; intron 1
ENSCAFT00000000474 ; CTDSP2-201; intron 5
antisense
ENSCAFT00000049505 ; XRCC6BP1-201; intron 1
Database links

Mature sequence cfa-miR-26a

Accession MIMAT0006595
Sequence

1 - 

uucaaguaauccaggauaggcu

 - 22

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).