Stem-loop sequence cfa-mir-33a

AccessionMI0007988 (change log)
Previous IDscfa-mir-33
DescriptionCanis familiaris miR-33 stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   --         a uu          uucu  c 
5'   gugcauugu g  gcauugcaug    gg g
     ||||||||| |  ||||||||||    || g
3'   uacgugaca c  uguaacgugc    cc u
   ac         c uu          ----  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr10: 23456613-23456673 [-]
sense
ENSCAFT00000001559 ; SREBF2-201; intron 16
Database links

Mature sequence cfa-miR-33a

Accession MIMAT0006593
Previous IDscfa-miR-33
Sequence

1 - 

gugcauuguaguugcauugc

 - 20

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).