Stem-loop sequence cel-mir-1824

AccessionMI0007986 (change log)
DescriptionCaenorhabditis elegans miR-1824 stem-loop
Literature search

1 open access papers mention cel-mir-1824
(2 sentences)

Stem-loop
   g   --       u   c       cu  - --     --      uac 
5'  uuc  accagag ugg aguguuu  cc c  ccaac  uuuugu   a
    |||  ||||||| ||| |||||||  || |  |||||  ||||||   g
3'  aag  uggucuc gcc ucacaag  gg g  gguug  aaaacg   a
   g   uu       c   u       -u  u cc     ua      uua 
Get sequence
Deep sequencing
119 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was erroneously named mir-809 in [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 13513955-13514047 [+]
antisense
Y87G2A.18 ; Y87G2A.18; intron 2
Database links

Mature sequence cel-miR-1824-5p

Accession MIMAT0006591
Previous IDscel-miR-1824
Sequence

13 - 

uggcaguguuucucccccaacuu

 - 35

Get sequence
Deep sequencing101 reads, 11 experiments
Evidence experimental; 454 [1], Illumina [2,4], CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-1824-3p

Accession MIMAT0020360
Sequence

57 - 

guuggccguggugaacacuuccgcc

 - 81

Get sequence
Deep sequencing14 reads, 2 experiments
Evidence experimental; Illumina [4]

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
4