Stem-loop sequence cel-mir-1823

AccessionMI0007985 (change log)
DescriptionCaenorhabditis elegans miR-1823 stem-loop
Literature search

1 open access papers mention cel-mir-1823
(1 sentences)

Stem-loop
   c      --    a   c  c     c -  a g        --g a 
5'  uuugac  cuga cgu ac ccuaa c cu u caguauuu   g g
    ||||||  |||| ||| || ||||| | || | ||||||||   |  
3'  agacug  gacu gua ug ggauu g ga a gucauaaa   c c
   a      uu    c   a  a     u u  - g        aua u 
Get sequence
Deep sequencing
3788 reads, 7.69 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was erroneously named mir-808 in [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 12608619-12608708 [+]
intergenic
Database links

Mature sequence cel-miR-1823-5p

Accession MIMAT0032035
Sequence

17 - 

accccuaacccuaugcaguauuu

 - 39

Get sequence
Deep sequencing44 reads, 10 experiments
Evidence not experimental
Database links

Mature sequence cel-miR-1823-3p

Accession MIMAT0006590
Previous IDscel-miR-1823
Sequence

53 - 

uacuggaaguguuuaggaguaa

 - 74

Get sequence
Deep sequencing3741 reads, 13 experiments
Evidence experimental; 454 [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2