Stem-loop sequence cel-mir-1822

AccessionMI0007984 (change log)
DescriptionCaenorhabditis elegans miR-1822 stem-loop
Gene family MIPF0001009; mir-1822
Stem-loop
   a       aaacu    u     c    -  aa   ua    c  aau 
5'  uucuuga     ccaa aguuu ucug gg  agc  ucgg ca   u
    |||||||     |||| ||||| |||| ||  |||  |||| ||    
3'  aagagcu     gguu ucaaa agac cc  ucg  agcc gu   u
   a       -acuc    c     a    u  cg   --    u  caa 
Get sequence
Deep sequencing
523 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was erroneously named mir-807 in [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 6015534-6015627 [+]
sense
ZK84.2 ; ZK84.2; intron 3
Database links

Mature sequence cel-miR-1822-5p

Accession MIMAT0015266
Previous IDscel-miR-1822*
Sequence

19 - 

aguuucucugggaaagcuaucggc

 - 42

Get sequence
Deep sequencing394 reads, 11 experiments
Evidence experimental; CLIPseq [4]
Database links
Predicted targets

Mature sequence cel-miR-1822-3p

Accession MIMAT0006589
Previous IDscel-miR-1822
Sequence

58 - 

gagcugcccucagaaaaacucu

 - 79

Get sequence
Deep sequencing127 reads, 14 experiments
Evidence experimental; 454 [1-2], Illumina [3], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).