Stem-loop sequence cel-mir-1821

AccessionMI0007983 (change log)
DescriptionCaenorhabditis elegans miR-1821 stem-loop
Literature search

2 open access papers mention cel-mir-1821
(4 sentences)

Stem-loop
   -      -     --   caa       c    ugc     uu        cgg 
5'  auaugu aguug  gua   guuugcc aacu   agacu  ucaauuuu   c
    |||||| |||||  |||   ||||||| ||||   |||||  ||||||||    
3'  uauaua ucaac  cau   cagaugg uuga   ucugg  aguuaagg   a
   a      a     au   uua       a    uau     --        uga 
Get sequence
Deep sequencing
2046 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was erroneously named mir-806 in [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 3042530-3042633 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-1821
cel-mir-1821chrV: 3042530-3042633 [-]
cel-mir-792chrV: 3042092-3042181 [-]
Database links

Mature sequence cel-miR-1821-5p

Accession MIMAT0032034
Sequence

21 - 

ugcccaacuugcagacuuuucaau

 - 44

Get sequence
Deep sequencing12 reads, 7 experiments
Evidence not experimental

Mature sequence cel-miR-1821-3p

Accession MIMAT0006588
Previous IDscel-miR-1821
Sequence

61 - 

ugaggucuuauaguuagguaga

 - 82

Get sequence
Deep sequencing2015 reads, 15 experiments
Evidence experimental; 454 [1-2], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5