Stem-loop sequence cel-mir-1821

Accession

MI0007983 (change log)

Description

Caenorhabditis elegans miR-1821 stem-loop

Literature search

2 open access papers mention cel-mir-1821
(4 sentences)

Stem-loop

   -      -     --   caa       c    ugc     uu        cgg 
5'  auaugu aguug  gua   guuugcc aacu   agacu  ucaauuuu   c
    |||||| |||||  |||   ||||||| ||||   |||||  ||||||||    
3'  uauaua ucaac  cau   cagaugg uuga   ucugg  aguuaagg   a
   a      a     au   uua       a    uau     --        uga 

Deep sequencing

2046 reads, 6.67 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence was erroneously named mir-806 in [1].

Genome context

• Coordinates (WBcel235; GCA_000002985.3): chrV: 3042530-3042633 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from cel-mir-1821

• cel-mir-1821: chrV: 3042530-3042633 [-]
• cel-mir-792: chrV: 3042092-3042181 [-]

Database links

• RNAcentral:URS000037E451_6239
• miRBase Tracker:MI0007983

Mature sequence cel-miR-1821-5p

• Accession: MIMAT0032034
• Sequence: 21 - ugcccaacuugcagacuuuucaau - 44
• Deep sequencing: 12 reads, 7 experiments
• Evidence: not experimental

Mature sequence cel-miR-1821-3p

• Accession: MIMAT0006588
• Previous IDs: cel-miR-1821
• Sequence: 61 - ugaggucuuauaguuagguaga - 82
• Deep sequencing: 2015 reads, 15 experiments
• Evidence: experimental; 454 [1-2], Illumina [3,5], CLIPseq [4]
• Database links:
  • RNAcentral:URS000059F05F_6239
• Predicted targets:
  • TargetScanWorm:cel-miR-1821
  • microrna.org:cel-miR-1821-3p

References

1. PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2. PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
3. PMID:19460142 "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development" Kato M, de Lencastre A, Pincus Z, Slack FJ Genome Biol. 10:R54(2009).
4. PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5. PMID:21307183 "Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer" Warf MB, Johnson WE, Bass BL RNA. 17:563-577(2011).