Stem-loop sequence cel-mir-1820

AccessionMI0007982 (change log)
DescriptionCaenorhabditis elegans miR-1820 stem-loop
Literature search

2 open access papers mention cel-mir-1820
(9 sentences)

Stem-loop
   u   a      c         cu           uu     au       aaau 
5'  uca aaauug auuuuccau  uuugauuguuu  cgaug  guucguu    c
    ||| |||||| |||||||||  |||||||||||  |||||  |||||||    g
3'  agu uuuaac uaagaggua  aaacuaacaaa  guuac  caagcga    g
   u   a      -         ag           -u     --       auau 
Get sequence
Deep sequencing
6880 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was erroneously named mir-805 in [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 7767461-7767567 [+]
intergenic
Database links

Mature sequence cel-miR-1820-5p

Accession MIMAT0006587
Previous IDscel-miR-1820
Sequence

23 - 

uuuugauuguuuuucgaugauguucg

 - 48

Get sequence
Deep sequencing6770 reads, 16 experiments
Evidence experimental; 454 [1-2], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

Mature sequence cel-miR-1820-3p

Accession MIMAT0020359
Previous IDscel-miR-1820*
Sequence

66 - 

aaccauuguaaacaaucaaaga

 - 87

Get sequence
Deep sequencing99 reads, 13 experiments
Evidence experimental; Illumina [5]
Database links

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5